|
Addgene inc
d 001810 10 05 pspax2 addgene D 001810 10 05 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/d 001810 10 05 pspax2 addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
d 001810 10 05 pspax2 addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pspax2 addgene Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
pspax2 addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pspax2 gift ![]() Pspax2 Gift, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 gift/product/Addgene inc Average 96 stars, based on 1 article reviews
pspax2 gift - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
n a recombinant dna plenticrisprv2 addgene ![]() N A Recombinant Dna Plenticrisprv2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n a recombinant dna plenticrisprv2 addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
n a recombinant dna plenticrisprv2 addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pspax2 addgene plasmid ![]() Pspax2 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 addgene plasmid/product/Addgene inc Average 96 stars, based on 1 article reviews
pspax2 addgene plasmid - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g addgene ![]() Pmd2 G Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2 g addgene/product/Addgene inc Average 94 stars, based on 1 article reviews
pmd2 g addgene - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
pljm1 sancak ![]() Pljm1 Sancak, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pljm1 sancak/product/Addgene inc Average 96 stars, based on 1 article reviews
pljm1 sancak - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pcas9 aavs1 sgrna addgene ![]() Pcas9 Aavs1 Sgrna Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcas9 aavs1 sgrna addgene/product/Addgene inc Average 93 stars, based on 1 article reviews
pcas9 aavs1 sgrna addgene - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
l 004759 00 0005 recombinant dna pcdna3 er gcamp3 mehta ![]() L 004759 00 0005 Recombinant Dna Pcdna3 Er Gcamp3 Mehta, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/l 004759 00 0005 recombinant dna pcdna3 er gcamp3 mehta/product/Addgene inc Average 93 stars, based on 1 article reviews
l 004759 00 0005 recombinant dna pcdna3 er gcamp3 mehta - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Becton Dickinson
flowjo10 ![]() Flowjo10, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flowjo10/product/Becton Dickinson Average 90 stars, based on 1 article reviews
flowjo10 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
JCRB Cell Bank
kms27 cells ![]() Kms27 Cells, supplied by JCRB Cell Bank, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kms27 cells/product/JCRB Cell Bank Average 90 stars, based on 1 article reviews
kms27 cells - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Carl Zeiss
axiophot fluorescent microscope ![]() Axiophot Fluorescent Microscope, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/axiophot fluorescent microscope/product/Carl Zeiss Average 90 stars, based on 1 article reviews
axiophot fluorescent microscope - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: Plasminogen activator inhibitor-1 promotes the recruitment and polarization of macrophages in cancer
doi: 10.1016/j.celrep.2018.10.082
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Carmeliet et al., 1993 Bajou et al., 2008 N/A Oligonucleotides ON-TARGET plus Set of 4 siRNA MAPK14 Dharmacon J-003512-20 ON-TARGET plus Set of 4 siRNA MAPK14 Dharmacon J-003512-20 ON-TARGET plus Set of 4 siRNA MAPK14 Dharmacon J-003512-20 ON-TARGET plus Set of 4 siRNA MAPK14 Dharmacon J-003512-20 ON-TARGET plus Set of 4 siRNA NF-κB p65 Dharmacon J-003533-06 ON-TARGET plus Set of 4 siRNA NF-κB p65 Dharmacon J-003533-06 ON-TARGET plus Set of 4 siRNA NF-κB p65 Dharmacon J-003533-06 ON-TARGET plus Set of 4 siRNA NF-κB p65 Dharmacon J-003533-06 ON-TARGET plus Non-targeting control Dharmacon D-001810-10-05 shPAI-1 5′- CCGGCAGACAGTTTCAGGCTGACTTCTCGAGAAGTCAGCC TGAAACTGTCTGTTTTT-3′ TRCN0000052271 shPAI-2 5′- AATTAAAAACAGACAGTTTCAGGCTGACTTCTCGAGAAGT CAGCCTGAAACTGTCTG-3′ TRCN0000052271 Scramble 1 5′- CCGGAATTCTCCGAACGTGTCACGTCTCGAGACGT N/A GACACGTTCGGAGAATTTTTTT-3′ Scramble 2 5′- AATTAAAAAAATTCTCCGAACGTGTCACGTCTCGAGACGTG ACACGTTCGGAGAATT-3′ N/A Recombinant DNA Tet-pLKO-puro lentiviral vector Wee et al., 2008 ; Wiederschain et al., 2009 Addgene Cat#21915
Techniques: Produced, Plasmid Preparation, Purification, Virus, Recombinant, Membrane, Modification, Saline, Mutagenesis, Binding Assay, Polymer, Blocking Assay, Staining, Enzyme-linked Immunosorbent Assay, Detection Assay, Control, Software